SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.09 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    4,021,429 4,021,845

    Biological materials


  • MGNA-B792 (yxiG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39190 ([gene|80CF0CAA551E9740AEEEA5EE2E860BF4405520D2|yxiG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCTGCCTCTTTTTAA, downstream forward: _UP4_TGATTTAAGGCTGAATTGGA
  • BKK39190 ([gene|80CF0CAA551E9740AEEEA5EE2E860BF4405520D2|yxiG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCTGCCTCTTTTTAA, downstream forward: _UP4_TGATTTAAGGCTGAATTGGA
  • References

  • 27766092