SubtiBank SubtiBank
yxiG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxiG

unknown
locus
BSU_39190
pI
4.15
mw
16.09 kDa
protein length
138 aa Sequence Blast
gene length
417 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,021,429 4,021,845

    Biological materials

    Mutant

  • MGNA-B792 (yxiG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1791 NBRP B. subtilis, Japan]
  • BKE39190 ([gene|80CF0CAA551E9740AEEEA5EE2E860BF4405520D2|yxiG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCTGCCTCTTTTTAA, downstream forward: _UP4_TGATTTAAGGCTGAATTGGA
  • BKK39190 ([gene|80CF0CAA551E9740AEEEA5EE2E860BF4405520D2|yxiG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCCTGCCTCTTTTTAA, downstream forward: _UP4_TGATTTAAGGCTGAATTGGA
  • References

  • 27766092