SubtiBank SubtiBank
sspA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sspA

small acid-soluble spore protein (major alpha-type SASP)
locus
BSU_29570
pI
4.73
mw
6.93 kDa
protein length
gene length
210 bp Sequence Blast
function
protection of spore DNA
product
small acid-soluble spore protein (major alpha-type SASP)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.3|Small acid-soluble spore proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,025,445 3,025,654

    Phenotypes of a mutant

  • a [gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA] mutant is sensitive to ionizing radiation [Pubmed|24123749]
  • a [gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA] [gene|28F47ADECD376494878AE58B395B3A2616B6B5DF|sspB] double mutant is sensitive to blue light-induced DNA damage [pubmed|30054368]
  • The protein

    Protein family

  • [SW|Alpha/beta-type SASP family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|SspC], [protein|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|SspD], [protein|28F47ADECD376494878AE58B395B3A2616B6B5DF|SspB]
  • Modification

  • phosphorylated on Ser-6, Ser-9-, Ser-47, and Ser-55 [Pubmed|26381121]
  • phosphorylated on Arg-55 [pubmed|31221751]
  • Structure

  • [PDB|2Z3X] ([protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|SspC] in complex with DNA, 83% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|741DCFFBB8FF6A4E357EE5110EBE24412DE34244|nifZ]-[gene|A64A59C2B15015F13911EC53763D370F780400FD|thiI]-[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]
    description
    [Pubmed|3009398]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|15699190,8755877]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BP137 (''[gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]''::''cat'') available in [SW|Fabian Commichau]'s lab
  • 1S109 (no resistance), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S109&Search=1S109 BGSC]
  • 1S111 (no resistance), [Pubmed|3087950], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S111&Search=1S111 BGSC]
  • 1S112 (no resistance), [Pubmed|3125155], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S112&Search=1S112 BGSC]
  • 1S113 (no resistance), [Pubmed|3125155], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S113&Search=1S113 BGSC]
  • BKE29570 ([gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCTCACCTCCTTGT, downstream forward: _UP4_TAATTTACAATTTCACATAA
  • BKK29570 ([gene|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|sspA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTCTCACCTCCTTGT, downstream forward: _UP4_TAATTTACAATTTCACATAA
  • References

  • 16707666,2456528,3009398,12884008,11092849,7608092,15458366,19542328,15699190,8755877,23064347,3087950,3125155,24123749,26381121,30054368,30782632,31221751