SubtiBank SubtiBank


similar to phage-related protein
19.71 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,681,627 2,682,130

    Biological materials


  • BKE26100 ([gene|80B17C770B9659D4884262E2E781A4FC2836E8F1|yqbI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAACTGATCGAGACCCCGAA, downstream forward: _UP4_GAAGAATTTTAAGGCGGTGC
  • BKK26100 ([gene|80B17C770B9659D4884262E2E781A4FC2836E8F1|yqbI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAACTGATCGAGACCCCGAA, downstream forward: _UP4_GAAGAATTTTAAGGCGGTGC
  • References

  • 27766092