SubtiBank SubtiBank
atpI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

atpI

ATP synthase (subunit i)
locus
BSU36880
pI
10.16
mw
14.35 kDa
protein length
127 aa Sequence Blast
gene length
384 bp Sequence Blast
function
ATP synthesis
product
ATP synthase (subunit i))
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.5|ATP synthesis] → [category|SW 2.1.5.1|ATPase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,787,620 3,788,003

    The protein

    Catalyzed reaction/ biological activity

  • ATP synthesis [http://www.youtube.com/watch?v=uOoHKCMAUMc see a video]
  • Protein family

  • bacterial atpI family (according to Swiss-Prot)
  • Effectors of protein activity

  • ATPase activity is inhibited upon binding of Mg-ADP to [protein|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|AtpD] [pubmed|30580998]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]-[gene|CC1894D90AC17487A286B2909964916825055F93|atpB]-[gene|6CF7F6303425D8A51E1E01BF18823139E4259A8F|atpE]-[gene|87311FEA265AD3F5526C78D631E7E51BBF01F0D6|atpF]-[gene|E956A30D97B2941108880F3AD48620C4DB6E0EBD|atpH]-[gene|E3FADE979CE6AB6315F67812608FCE00CF4E2453|atpA]-[gene|492EEC8068043DA770F5DC1D54799C4366AE9A01|atpG]-[gene|2A566C2CF8F7B86E05EEF4B7A268E8C102070025|atpD]-[gene|A9DA64F8C7A60E8E2B1EDC99BEA1BD7DD0135AA6|atpC]
    description
    [Pubmed|9353933]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • the mRNA is processed between [gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI] and [gene|CC1894D90AC17487A286B2909964916825055F93|atpB] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE36880 ([gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTATCTGTCTCCTG, downstream forward: _UP4_TCAATGGAAGAGAGGTGAAA
  • BKK36880 ([gene|8027AD5C3A92FB9B70E42C119FDEC697A64618C4|atpI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAATTATCTGTCTCCTG, downstream forward: _UP4_TCAATGGAAGAGAGGTGAAA
  • References

  • 7961438,29794222,30580998