SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcription repressor of the fruR-fruK-fruA operon, DeoR family
27.67 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
regulation of fructose utilization
transcription repressor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of fructose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    1,507,578 1,508,333

    Expression and Regulation



    regulatory mechanism

  • [protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]: repression, (according to [ DBTBS]), in [regulon|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR regulon]
  • regulation

  • induced in the presence of fructose ([protein|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|FruR]) (according to [ DBTBS])
  • view in new tab

    Biological materials


  • BKE14380 ([gene|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|fruR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCACCTCCTAATGA, downstream forward: _UP4_ACTGTCGTAAAGGTAGTGAA
  • BKK14380 ([gene|7FD2294B0538EB6D83DC3E0752600D2464CDE4A3|fruR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCACCTCCTAATGA, downstream forward: _UP4_ACTGTCGTAAAGGTAGTGAA
  • References

  • 14651647,10627040