SubtiBank SubtiBank
pnbA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pnbA

para-nitrobenzyl esterase
locus
BSU34390
pI
4.78
mw
53.82 kDa
protein length
489 aa Sequence Blast
gene length
1470 bp Sequence Blast
function
lipid degradation
product
para-nitrobenzyl esterase
essential
no
ec
3.1.1.3
synonyms
estB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.4|Utilization of lipids/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,530,635 3,532,104

    The protein

    Catalyzed reaction/ biological activity

  • Triacylglycerol + H2O = diacylglycerol + a carboxylate (according to Swiss-Prot)
  • Protein family

  • type-B carboxylesterase/lipase family (according to Swiss-Prot)
  • Modification

  • phosphorylation on Ser-189 [Pubmed|17218307]
  • Structure

  • [PDB|1C7J] [Pubmed|10535917]
  • Expression and Regulation

    Operons

    genes
    [gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|18840696], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logarithmic growth ([protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]) [Pubmed|18840696]
  • view in new tab

    genes
    [gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]-[gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: activation, [Pubmed|19767430], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|19788541], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI], [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541] or by SlrR itself [PubMed|20351052]
  • view in new tab

    Biological materials

    Mutant

  • GP951 (''pnbA''::''cat''), available in [SW|Jörg Stülke]'s lab
  • GP955 (''[gene|920F91E748EE079FF864011D9052B073567C41E4|slrR]''-''pnbA''::''cat''), available in [SW|Jörg Stülke]'s lab
  • BKE34390 ([gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTCTCTCCCTTTT, downstream forward: _UP4_TAAATATGGGGAAAACAGGA
  • BKK34390 ([gene|7FCB9037FDDC176FCF76088ADE7387A6A37068A9|pnbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTGTTCTCTCCCTTTT, downstream forward: _UP4_TAAATATGGGGAAAACAGGA
  • References

  • 7828905,21574267,17218307,10535917,22127613,25077141