SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


cation exporter (antiporter), exchange for extracellular K+ and H+
34.01 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
cation efflux, resistence against Zn, Cu, Co, Ni
cation exporter (antiporter)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Zinc]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,723,892 2,724,827

    The protein

    Catalyzed reaction/ biological activity

  • antiport of cytoplasmic Zn2+ in exchange for extracellular K+ and H+ [pubmed|12100555]
  • Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA]: repression, [Pubmed|15948947], in [regulon|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA regulon]
  • regulation

  • induced in the presence of toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|15948947]
  • view in new tab

    Biological materials


  • BKE26650 ([gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCCTCCTTAC, downstream forward: _UP4_TAAATTTTTTATCTAACTTT
  • BKK26650 ([gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCCTCCTTAC, downstream forward: _UP4_TAAATTTTTTATCTAACTTT
  • References

  • 15948947,12100555