SubtiBank SubtiBank
czcD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

czcD

cation exporter (antiporter), export of zinc in exchange for extracellular K+ and H+
locus
BSU_26650
pI
5.86
mw
34.01 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
function
cation efflux, resistence against Zn, Cu, Co, Ni
product
cation exporter (antiporter)
essential
no
synonyms
yrdO

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.3|Zinc]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,723,892 2,724,827

    The protein

    Catalyzed reaction/ biological activity

  • antiport of cytoplasmic Zn2+ in exchange for extracellular K+ and H+ [pubmed|12100555]
  • Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]-[gene|6D6C324675631B5CAB165D6DF72AA45BF3DB6F29|czcO]
    description
    [Pubmed|15948947]

    regulatory mechanism

  • [protein|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA]: repression, [Pubmed|15948947], in [regulon|6FB1865734C4DE7BE19D3D1A7E0C687B6D7094E1|CzrA regulon]
  • regulation

  • induced in the presence of toxic metal ions (Zn(II), Cd(II), Co(II), Ni(II) and Cu(II)) ([protein|search|CzrA]) [Pubmed|15948947]
  • view in new tab

    Biological materials

    Mutant

  • BKE26650 ([gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCCTCCTTAC, downstream forward: _UP4_TAAATTTTTTATCTAACTTT
  • BKK26650 ([gene|7FB5BCC16D688465A820F436F657C49625257884|czcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAACTCCTCCTTAC, downstream forward: _UP4_TAAATTTTTTATCTAACTTT
  • References

  • 15948947,12100555