SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


dipeptide [SW|ABC transporter ](ATP-binding protein)
36.53 kDa
protein length
335 aa Sequence Blast
gene length
1008 bp Sequence Blast
uptake of dipeptides
dipeptide [SW|ABC transporter ](ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of peptides]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,363,141 1,364,148

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|OppD], [protein|325BCDCAB4003204294229B7F9F0A5F353D72B54|AppD]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 7-256) (according to UniProt)
  • Structure

  • [PDB|4FWI] (from Caldanaerobacter subterraneus, 38% identity) [pubmed|23385461]
  • [SW|Localization]

  • attached to the cell membrane (via [protein|062AE5FB4C778178A7F6833CB8BD9D631E461E89|DppB]-[protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|DppC]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1766371], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|7783641], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed by glucose (2.9-fold) [Pubmed|12850135]
  • view in new tab


    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • BKE12950 ([gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTGACAGAACTTTTTCCA, downstream forward: _UP4_TCAGGAGATGCGAAGGATTG
  • BKK12950 ([gene|7FA72D949B930A3C7FF0391CC6CCC58EEFCA839A|dppD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTGACAGAACTTTTTCCA, downstream forward: _UP4_TCAGGAGATGCGAAGGATTG
  • References

  • 12618455,10092453,1766371,7783641,1766371,23385461