SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


acetylornithine transaminase
40.74 kDa
protein length
385 aa Sequence Blast
gene length
1155 bp Sequence Blast
biosynthesis of arginine
acetylornithine transaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • Gene

    1,198,099 → 1,199,256

    The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + N2-acetyl-L-ornithine --> L-glutamate + N-acetyl-L-glutamate 5-semialdehyde (according to UniProt)
  • Protein family

  • [SW|Class-III pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2EH6] (from Aquifex aeolicus, 45% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • BKE11220 (Δ[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATGAAACAGCCTCCTT, downstream forward: _UP4_TGATTTTTTTTCGATATAAA
  • BKK11220 (Δ[gene|7FA5502FE82D55EC176F68B74B24293EC9B7D4D7|argD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTCATGAAACAGCCTCCTT, downstream forward: _UP4_TGATTTTTTTTCGATATAAA
  • References

  • 6096675,24843172,12107147,1312212,7511775