SubtiBank SubtiBank
mscL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mscL

large conductance mechanosensitive channel protein, prevents selective release of cytoplasmic proteins in a hypotonic environment
locus
BSU_36360
pI
4.65
mw
14.14 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
resistance to osmotic downshock, glycine betaine export
product
large conductance mechanosensitive channel protein
essential
no
synonyms
ywpC

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.7|Coping with hypo-osmotic stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,743,267 3,743,659

    Phenotypes of a mutant

  • sensitive to osmotic downshock (> 0.5 M) during logarithmic growth [Pubmed|19252899]
  • The protein

    Protein family

  • mscL family (single member, according to UniProt)
  • Structure

  • [PDB|3HZQ] (MscL of ''Staphylococcus aureus'') [Pubmed|19701184]
  • [SW|Localization]

  • cell membrane [Pubmed|19252899]
  • Expression and Regulation

    Operons

    genes
    [gene|BDA23FA513C240B07DC109BB62A7A5EB96B20965|ywpB]-[gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]
    description
    [Pubmed|22383849]

    regulation

  • expressed in logarithmic phase [Pubmed|19252899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A562 (ywpC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/562 NBRP B. subtilis, Japan]
  • 1A957 ( ''mscL''::''spec''), [Pubmed|18310427], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A957&Search=1A957 BGSC]
  • BKE36360 ([gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC, downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA
  • BKK36360 ([gene|7F7BC285A1D02B031575BA7E980293CD2962C84A|mscL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCACCTGCTTTTC, downstream forward: _UP4_TAAAAAAGATGCCGTTAGAA
  • References

    Reviews

  • 12626684,19727188,20825352,22685280,24258154,22685280,24607989,17505523
  • Original Publications

  • 17665170,18310427,19160392,16897034,19252899,19701184,9632260,19738010,9353933
  • Labs working on this gene/protein

  • [SW|Jan Maarten van Dijl], Groningen, Netherlands
  • [SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]