SubtiBank SubtiBank
yqeM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqeM

similar to SAM-dependent methyltransferase
locus
BSU_25610
pI
4.26
mw
28.18 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,642,101 2,642,844

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • SAM
  • Structure

  • [PDB|3D2L] (from Exiquobacterium sp., 45% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|722FD63050EED803C859FFD61338C02D5BB4CC1C|yqeG]-[gene|959C0ED7B9DA50F0EADCF1565405B878D36DA206|yqeH]-[gene|776D79C45DADA631D4A75B0773CFF471A87D9EEC|aroD]-[gene|7774FC36BAEAD33EDD48CB77DA0B5E7E0EA38CA2|yqeI]-[gene|AA4BB1F5B58371D536A6BBA86F6ECB5E5BFB12A8|nadD]-[gene|247C47AC70A0EA53E625871D9BC463A06E6B05FB|yqeK]-[gene|B9D5E9B566D28423232C1A28C966CDEA0E5A6B78|yqeL]-[gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C499 (yqeM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2497 NBRP B. subtilis, Japan]
  • BKE25610 ([gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTGCAAAGCCTTGAT, downstream forward: _UP4_TAAAACGATGGTTTTTTAAA
  • BKK25610 ([gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTGCAAAGCCTTGAT, downstream forward: _UP4_TAAAACGATGGTTTTTTAAA
  • References

  • 22383849