SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to SAM-dependent methyltransferase
28.18 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,642,101 2,642,844

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|Cofactors]

  • SAM
  • Structure

  • [PDB|3D2L] (from Exiquobacterium sp., 45% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C499 (yqeM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE25610 ([gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTGCAAAGCCTTGAT, downstream forward: _UP4_TAAAACGATGGTTTTTTAAA
  • BKK25610 ([gene|7F63251ABC07F6C11C57B62CBB948240B08D0181|yqeM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTTGCAAAGCCTTGAT, downstream forward: _UP4_TAAAACGATGGTTTTTTAAA
  • References

  • 22383849