SubtiBank SubtiBank
rpmI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rpmI

ribosomal protein
locus
BSU_28860
pI
12.52
mw
7.42 kDa
protein length
gene length
201 bp Sequence Blast
function
translation
product
ribosomal protein L35
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.4|Ribosomal proteins]
  • Gene

    Coordinates
    2,952,615 2,952,815

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bL35 family (single member, according to UniProt)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Additional information

  • the protein is significantly underrepresented in 45S assembly intermediates that accumulate upon depletion of [protein|54CD247926F7FABE4ACE85EB7021B62500B47260|RbgA] [Pubmed|24335279,23700310]
  • Expression and Regulation

    Operons

    genes
    [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA]
    description
    [Pubmed|17289755]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT]: termination, via binding to a [SW|RNA switch] in the [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC] leader region causes transcription termination, in [regulon|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT regulon]
  • regulation

  • [protein|CEE73284EFC0DBE8870CE0B474922DED79475A57|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • autorepression of [gene|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|infC]-[gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]-[gene|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|rplT]-[gene|19349FDFE0F9A46FCCAA684B8139E592979DB317|ysdA] expression upon binding of excess [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|RplT] to the untranslated region of the mRNA [Pubmed|29925569,17616982]
  • expression of [protein|E27012060B8220E55277A23C20B1BA6DDBBA4AD1|IF3 ]is uncoupled from that of [protein|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|L35 ]and [protein|803313600B3CEEE742BD6E5D650B94FB2D32B9EF|L20 ]by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y]-dependent mRNA processing [PubMed|21843271]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • BKE28860 ([gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATTTCCTCCTTATT, downstream forward: _UP4_TAATCGGATAAGGAACAATT
  • BKK28860 ([gene|7F22743ED669DBCD4089EA2F86B8FFD924F8C2B9|rpmI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28860 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGGATTTCCTCCTTATT, downstream forward: _UP4_TAATCGGATAAGGAACAATT
  • References

  • 19653700,17289755,11948165,21843271,23002217,24335279,23700310,25903689,29925569