SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to multidrug transporter
43.10 kDa
protein length
403 aa Sequence Blast
gene length
1212 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,605,523 3,606,734

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|TCR/Tet family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135]; [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR] auto-repression [Pubmed|27542896], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: repression, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • regulation

  • induced by iron starvation [Pubmed|27542896]
  • view in new tab

    Biological materials


  • BKE35090 ([gene|7F10DEEDEF8B679F4F2C5EAD5752F4E399DB0D57|yvmA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGTACACCGCCTTTT, downstream forward: _UP4_TAAAAAAGCTGCCTTTGCGG
  • BKK35090 ([gene|7F10DEEDEF8B679F4F2C5EAD5752F4E399DB0D57|yvmA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGTACACCGCCTTTT, downstream forward: _UP4_TAAAAAAGCTGCCTTTGCGG
  • References

  • 22383849,27542896