SubtiBank SubtiBank
yvmA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvmA

similar to multidrug transporter
locus
BSU_35090
pI
9.69
mw
43.10 kDa
protein length
403 aa Sequence Blast
gene length
1212 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,605,523 3,606,734

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|TCR/Tet family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0D555F2AB7DC863E6FF388888308E980514DB719|pchR]-[gene|7F10DEEDEF8B679F4F2C5EAD5752F4E399DB0D57|yvmA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135]; [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR] auto-repression [Pubmed|27542896], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: repression, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • regulation

  • induced by iron starvation [Pubmed|27542896]
  • view in new tab

    Biological materials

    Mutant

  • BKE35090 ([gene|7F10DEEDEF8B679F4F2C5EAD5752F4E399DB0D57|yvmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGTACACCGCCTTTT, downstream forward: _UP4_TAAAAAAGCTGCCTTTGCGG
  • BKK35090 ([gene|7F10DEEDEF8B679F4F2C5EAD5752F4E399DB0D57|yvmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGTGTACACCGCCTTTT, downstream forward: _UP4_TAAAAAAGCTGCCTTTGCGG
  • References

  • 22383849,27542896