SubtiBank SubtiBank
ywqK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywqK

antitoxin
locus
BSU_36180
pI
4.49
mw
18.07 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
antitoxin, inhibition of the cytotoxic activity of [protein|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|YwqJ]
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • Gene

    Coordinates
    3,725,146 3,725,610

    Expression and Regulation

    Operons

    genes
    [gene|2401A4E3E5E683472C51AB2F31BC4F54F672F32A|ywqH]-[gene|04376B3166B591132CE37D1DE85B0ECFEC6902EF|ywqI]-[gene|2F9C623DDF9F93EFD46F024FDA3AF2A92FC9BF7A|ywqJ]-[gene|7ED407717C216FCB2B281A3ECFAA2ED594F021AF|ywqK]-[gene|F2C6956D69FBE57933E46136436E8E80B63DF8BB|ywqL]
    description
    [Pubmed|22383849]

    regulation

  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A568 (ywqK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/568 NBRP B. subtilis, Japan]
  • BKE36180 ([gene|7ED407717C216FCB2B281A3ECFAA2ED594F021AF|ywqK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTTTCCATACTTTAA, downstream forward: _UP4_TTAGGTCGAGAGTGAGCAAT
  • BKK36180 ([gene|7ED407717C216FCB2B281A3ECFAA2ED594F021AF|ywqK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTTTCCATACTTTAA, downstream forward: _UP4_TTAGGTCGAGAGTGAGCAAT
  • References

  • 22383849