SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


Holliday junction DNA helicase, part of the [protein|7EBC90946E7167A3B0212193873855CAE0EFF7D4|RuvA]-[protein|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|RuvB] branch migration translocase
22.44 kDa
protein length
201 aa Sequence Blast
gene length
606 bp Sequence Blast
[SW|DNA repair/ recombination]
Holliday junction DNA helicase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Double strand breaks repair]
  • Gene

    2,836,165 2,836,770

    Phenotypes of a mutant

  • the inactivations of ''[gene|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|recU]'' and ''[gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]'' are synthetically lethal [Pubmed|24770420]
  • the inactivations of ''[gene|A3D05FE662CCCFE79B3CB38486206413B84E5D80|recD2]'' and ''[gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB]'' are synthetically lethal [pubmed|28527403]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibits resolution of Holliday junctions by [protein|ED1E2011C7E43A8B7E9FD9A471BC11B9DEA73177|RecU]-[protein|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|RuvB] [Pubmed|24770420]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • ruvA family (single member, according to UniProt)
  • Structure

  • [PDB|1BDX] (from E. coli, 34% identity) [pubmed|9628481]
  • Expression and Regulation




  • the mRNA is processed between [gene|0383C8214ADE2FF70CFDB953A65648B37A9D3216|tgt] and [gene|D15B74263167DAD3FA9B7384B5AA4897EAD498F2|yrbF] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • view in new tab


    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials


  • GP3530 (Δ([gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]-[gene|8DFD57B73FE5D49BB547E050182A96CE6E8BFF77|ruvB])::kan), available in [SW|Jörg Stülke]'s lab
  • 1A896 (no resistance), [Pubmed|16020779], available at [ BGSC]
  • BKE27740 ([gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCACCTCTTTG, downstream forward: _UP4_AAACTATTAAAGTAAGGTGA
  • BKK27740 ([gene|7EBC90946E7167A3B0212193873855CAE0EFF7D4|ruvA]::kan trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCACCTCTTTG, downstream forward: _UP4_AAACTATTAAAGTAAGGTGA
  • References


  • 22933559,9442895
  • Original publications

  • 16267290,24770420,16020779,9628481,28527403