SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


flagellar hook-basal body protein
11.44 kDa
protein length
106 aa Sequence Blast
gene length
321 bp Sequence Blast
movement and chemotaxis
flagellar hook-basal body protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Flagellar proteins]
  • Gene

    1,692,130 1,692,450

    Phenotypes of a mutant

  • defective in swarming and flagellar assembly [pubmed|30201778]
  • The protein

    Protein family

  • fliE family (single member, according to UniProt)
  • [SW|Localization]

  • bacterial flagellum basal body (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE16200 ([gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATTCACCTACTTT, downstream forward: _UP4_TAGGGGGTCTGACGATTTAG
  • BKK16200 ([gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCATTCACCTACTTT, downstream forward: _UP4_TAGGGGGTCTGACGATTTAG
  • References

  • 1905667,17850253,14651647,9657996,8157612,15175317,24386445,30201778