SubtiBank SubtiBank
yodF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yodF

similar to amino acid permease
locus
BSU_19580
pI
9.68
mw
53.60 kDa
protein length
496 aa Sequence Blast
gene length
1491 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.1|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.4|Putative amino acid transporter]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,130,377 2,131,867

    The protein

    Catalyzed reaction/ biological activity

  • in some database, the protein is annotated as being similar to proline permease, however, it is not involved in proline transport [Pubmed|24142252]
  • Protein family

  • [SW|sodium:solute symporter (SSF) (TC 2.A.21) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EFA18ACD034D48868CD97470F81F23976DA300DF|YhjB]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]-[gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103,12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B437 (yodF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1436 NBRP B. subtilis, Japan]
  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • GP1887 Δ[gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]::kan, available in [SW|Jörg Stülke]'s lab
  • BKE19580 ([gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGTGCAGTCAGATTCCCTT, downstream forward: _UP4_TAAAAAAACCATACGCGGCA
  • BKK19580 ([gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGTGCAGTCAGATTCCCTT, downstream forward: _UP4_TAAAAAAACCATACGCGGCA
  • References

  • 12823818,22383849,12107147,18763711,24142252,25755103