SubtiBank SubtiBank
yodF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yodF

similar to amino acid permease
locus
BSU19580
pI
9.68
mw
53.60 kDa
protein length
496 aa Sequence Blast
gene length
1491 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.1|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.4|Putative amino acid transporter]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,130,377 2,131,867

    The protein

    Catalyzed reaction/ biological activity

  • in some database, the protein is annotated as being similar to proline permease, however, it is not involved in proline transport [Pubmed|24142252]
  • Protein family

  • solute:sodium symporter family (SSS family)
  • Paralogous protein(s)

  • [protein|EFA18ACD034D48868CD97470F81F23976DA300DF|YhjB]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|80D8589800BC9BA6743534311B6F227A37E7DB2D|yoyD]-[gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|25755103,12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B437 (yodF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1436 NBRP B. subtilis, Japan]
  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • GP1887 Δ[gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]::kan, available in [SW|Jörg Stülke]'s lab
  • BKE19580 ([gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGTGCAGTCAGATTCCCTT, downstream forward: _UP4_TAAAAAAACCATACGCGGCA
  • BKK19580 ([gene|7E86EB6FF86F2C4AE3FD11DB8CE8E71696D94B1B|yodF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGTGCAGTCAGATTCCCTT, downstream forward: _UP4_TAAAAAAACCATACGCGGCA
  • References

  • 12823818,22383849,12107147,18763711,24142252,25755103