SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


carbamoyl-phosphate transferase-arginine (subunit B)
112.75 kDa
protein length
1030 aa Sequence Blast
gene length
3093 bp Sequence Blast
biosynthesis of arginine
carbamoyl-phosphate transferase-arginine (subunit B)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of arginine]
  • Gene

    1,200,381 1,203,473

    The protein

    Catalyzed reaction/ biological activity

  • 2 ATP + H2O + hydrogencarbonate + L-glutamine --> 2 ADP + carbamoyl phosphate + 2 H+ + L-glutamate + phosphate (according to UniProt)
  • Protein family

  • carB family (with [protein|D57DC8A53E52BC4A2EA894E3C9FD983592882918|PyrAB], according to UniProt)
  • Paralogous protein(s)

  • [protein|D57DC8A53E52BC4A2EA894E3C9FD983592882918|PyrAB]
  • [SW|Domains]

  • 2 [SW|ATP-grasp doamin]s (aa 133-327, aa 675-863) (according to UniProt)
  • MGS-like domain (aa 925-1027) (according to UniProt)
  • Structure

  • [PDB|1JDB] (from ''Escherichia coli'', 47% identity, 64% similarity) [Pubmed|10089390]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: repression, [Pubmed|1312212], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|24843172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • repressed by arginine ([protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]) [Pubmed|1312212]
  • induced in the absence of [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • BKE11240 ([gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATATGCTTGAAATACTGG, downstream forward: _UP4_CTCTATAAAAAGGAAGTGGC
  • BKK11240 ([gene|7E6386F1949A6F46E4332BAB8F803742EB076AF0|carB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAATATGCTTGAAATACTGG, downstream forward: _UP4_CTCTATAAAAAGGAAGTGGC
  • References

  • 6096675,12107147,15378759,24843172,1312212,7511775