SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to tellurium resistance protein
21.68 kDa
protein length
199 aa Sequence Blast
gene length
600 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.12|Resistance against toxic metals/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    312,159 312,758

    The protein

    Protein family

  • CAPAB/TerDEXZ family (with [protein|DF30A8B195B8D830E131B23C768F07BE61F51150|YceD] and [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|YceE], according to UniProt)
  • Paralogous protein(s)

  • [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|YceE], [protein|DF30A8B195B8D830E131B23C768F07BE61F51150|YceD]
  • Structure

  • [PDB|3IBZ] (from Streptomyces coelicolor, 47% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|19047346], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE02890 ([gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACGATTCACTCCTACTC, downstream forward: _UP4_TAAAAGAAAAGGAGTGGATG
  • BKK02890 ([gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACGATTCACTCCTACTC, downstream forward: _UP4_TAAAAGAAAAGGAGTGGATG
  • References

  • 11544224,11866510,18179421,19047346