SubtiBank SubtiBank
yjnA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjnA

unknown
locus
BSU_12400
pI
10.62
mw
26.99 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,312,851 1,313,615

    The protein

    Protein family

  • [SW|4-toluene sulfonate uptake permease (TSUP) (TC 2.A.102) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7E43004F530F01417B29BF9988726A5A3835B8A7|yjnA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A357 (yjnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/357 NBRP B. subtilis, Japan]
  • BKE12400 ([gene|7E43004F530F01417B29BF9988726A5A3835B8A7|yjnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAGGCCTCCTGAA, downstream forward: _UP4_TAATGAAGAAGGCTATCCGC
  • BKK12400 ([gene|7E43004F530F01417B29BF9988726A5A3835B8A7|yjnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAGGCCTCCTGAA, downstream forward: _UP4_TAATGAAGAAGGCTATCCGC
  • References

  • 22383849