SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


26.99 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,312,851 1,313,615

    The protein

    Protein family

  • [SW|4-toluene sulfonate uptake permease (TSUP) (TC 2.A.102) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A357 (yjnA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12400 ([gene|7E43004F530F01417B29BF9988726A5A3835B8A7|yjnA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAGGCCTCCTGAA, downstream forward: _UP4_TAATGAAGAAGGCTATCCGC
  • BKK12400 ([gene|7E43004F530F01417B29BF9988726A5A3835B8A7|yjnA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAAGGCCTCCTGAA, downstream forward: _UP4_TAATGAAGAAGGCTATCCGC
  • References

  • 22383849