SubtiBank SubtiBank
mtrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mtrA

methylthioribose transporter
locus
BSU07340
pI
9.82
mw
48.74 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
function
uptake of methylthioribose
product
methylthioribose transporter
essential
no
synonyms
yfnA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW 2.6.4.2|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    805,456 806,841

    The protein

    Catalyzed reaction/ biological activity

  • uptake of methylthioribose [pubmed|29280348]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|BcaP]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]-[gene|2E1E22349750C3EE9B6575EED30A82ED0D5F07F0|yfnB]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2379 ∆''[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]''::''kan'', available in [SW|Jörg Stülke]'s lab
  • MGNA-C231 (yfnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2229 NBRP B. subtilis, Japan]
  • BKE07340 ([gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAGTTCCTCCTAGA, downstream forward: _UP4_TAATCTCTTTTCAGCCGGCG
  • BKK07340 ([gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAGTTCCTCCTAGA, downstream forward: _UP4_TAATCTCTTTTCAGCCGGCG
  • Expression vector

  • pGP2281: expression of ''[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2278 (in [SW|pAC5]) (GP2964), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711,29280348,29416041