SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


methylthioribose transporter
48.74 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
uptake of methylthioribose
methylthioribose transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.4|Sulfur metabolism] → [category|SW|sulfur metabolism/ general]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    805,456 806,841

    The protein

    Catalyzed reaction/ biological activity

  • uptake of methylthioribose [pubmed|29280348]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|BcaP]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • GP2379 ∆''[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]''::''kan'', available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-C231 (yfnA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07340 ([gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAGTTCCTCCTAGA, downstream forward: _UP4_TAATCTCTTTTCAGCCGGCG
  • BKK07340 ([gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAAAGTTCCTCCTAGA, downstream forward: _UP4_TAATCTCTTTTCAGCCGGCG
  • Expression vector

  • pGP2281: expression of ''[gene|7E180420EB053D9EF7993EF600A169C446F905F9|mtrA]'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2278 (in [SW|pAC5]) (GP2964), available in [SW|Jörg Stülke]'s lab
  • References

  • 18763711,29280348,29416041