SubtiBank SubtiBank
ypdP [2019-06-26 11:01:46]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ypdP [2019-06-26 11:01:46]

similar to queuosine precursor transporter
25.52 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
putative queuosine precursor transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,309,730 2,310,419

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A872 (ypdP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE21980 ([gene|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATGAAAAAGCTTCCTT, downstream forward: _UP4_CCTAATGATGAAAGGAGTTC
  • BKK21980 ([gene|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATGAAAAAGCTTCCTT, downstream forward: _UP4_CCTAATGATGAAAGGAGTTC
  • References

  • 22383849,28208705