SubtiBank SubtiBank
ypdP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypdP

similar to queuosine precursor transporter
locus
BSU_21980
pI
8.69
mw
25.52 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
function
unknown
product
putative queuosine precursor transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,309,730 2,310,419

    The protein

    Protein family

  • vitamin uptake transporter (VUT/ECF) (TC 2.A.88) family (with [protein|9685A380F95F1A73A693B53E4D35A1CB51043FEC|ThiT] and [protein|97573C2D4FD8BE6B4C749C0644D053C9A0CBFFF3|TrpP], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP]-[gene|09343BE8357AB24C79B69816FAE65D161E668F01|ypdQ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A872 (ypdP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/872 NBRP B. subtilis, Japan]
  • BKE21980 ([gene|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATGAAAAAGCTTCCTT, downstream forward: _UP4_CCTAATGATGAAAGGAGTTC
  • BKK21980 ([gene|7DD4BB8222B2EFE81C32C5521A29256095B9D6C1|ypdP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATGAAAAAGCTTCCTT, downstream forward: _UP4_CCTAATGATGAAAGGAGTTC
  • References

  • 22383849,28208705