SubtiBank SubtiBank
bpsA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bpsA

type III polyketide synthase
locus
BSU22050
pI
7.96
mw
40.55 kDa
protein length
365 aa Sequence Blast
gene length
1098 bp Sequence Blast
function
polyketide synthesis
product
type III polyketide synthase
essential
no
ec
2.3.1.74
synonyms
bcsA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    2,316,956 2,318,053

    The protein

    Catalyzed reaction/ biological activity

  • synthesis of triketide pyrones from long-chain fatty acyl CoA thioesters as starter substrates and malonyl-CoA as an extender substrate [Pubmed|19465653]
  • Protein family

  • chalcone/stilbene synthases family (according to UniProt)
  • Structure

  • [PDB|4JAO] (from Mycobacterium tuberculosis, 34% identity) [pubmed|23615910]
  • Expression and Regulation

    Operons

    genes
    [gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]-[gene|6BAF5763249305F27326F941A34956396B3F8C99|bpsB]
    description
    [Pubmed|19465653]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A875 (bcsA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/875 NBRP B. subtilis, Japan]
  • BKE22050 (''[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1820 (''[gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]''::''erm'', available in [SW|Jörg Stülke]'s lab)
  • BKE22050 ([gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATCACCTCTTTGCA, downstream forward: _UP4_AGCTGGGAAAAGGGGGCCTG
  • BKK22050 ([gene|7D90F7AF49BAD6A95731BF805991DEBBBCAFA46C|bpsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATCACCTCTTTGCA, downstream forward: _UP4_AGCTGGGAAAAGGGGGCCTG
  • References

  • 19465653,23615910