SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


acyl-CoA dehydrogenase
41.29 kDa
protein length
379 aa Sequence Blast
gene length
1140 bp Sequence Blast
fatty acid degradation
acyl-CoA dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of fatty acids]
  • Gene

    3,813,246 3,814,385

    The protein

    Catalyzed reaction/ biological activity

  • A + 2,3-saturated acyl-CoA --> 2,3-dehydroacyl-CoA + AH2 (according to UniProt)
  • Protein family

  • [SW|Acyl-CoA dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B5325CBF1408E2CA227EB462092E209F4C87E797|FadE], [protein|BA28DFBAF88A4994B0541D1FF2187312FDE1FA15|YngJ], [protein|F25CDDEBAFC72036664323619F5197D45E86BE9A|MmgC]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|2Z1Q] (from ''Thermus thermophilus hb8'', 40% identity, 55% similarity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17189250], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]: repression, [Pubmed|17189250], in [regulon|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR regulon]
  • regulation

  • repressed in the absence of long-chain fatty acids ([protein|8A8F93BAD0582F712C9EE1C3FE6C04292E91F390|FadR]) [Pubmed|17189250]
  • view in new tab

    Biological materials


  • BKE37170 ([gene|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTGCTTCTCCCCCAT, downstream forward: _UP4_TAACGGAAAACATCTCTCAG
  • BKK37170 ([gene|7D89BBB52403BF99416250688EFA90C2BE8EB591|acdA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTGCTTCTCCCCCAT, downstream forward: _UP4_TAACGGAAAACATCTCTCAG
  • References

  • 17189250,17919287