SubtiBank SubtiBank
bstB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bstB

bacillithiol S-transferase
locus
BSU_31030
pI
6.20
mw
18.97 kDa
protein length
162 aa Sequence Blast
gene length
489 bp Sequence Blast
function
unknown
product
bacillithiol S-transferase
essential
no
synonyms
yuaE

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,182,707 3,183,195

    The protein

    Protein family

  • [SW|S-transferase-like (STL) superfamily] [pubmed|29451913]
  • Structure

  • [PDB|2RD9] (from B. halodurans, 27% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|7D881A72C0DA181DEC8D8248127F44F81678F0FE|bstB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A220 (yuaE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/220 NBRP B. subtilis, Japan]
  • BKE31030 ([gene|7D881A72C0DA181DEC8D8248127F44F81678F0FE|bstB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCTCCTCCTAAAA, downstream forward: _UP4_AAGATAGAAAGGGCCTGATT
  • BKK31030 ([gene|7D881A72C0DA181DEC8D8248127F44F81678F0FE|bstB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCTCCTCCTAAAA, downstream forward: _UP4_AAGATAGAAAGGGCCTGATT
  • References

    Research papers

  • 29451913