SubtiBank SubtiBank
amyX
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

amyX

pullulanase (debranching enzyme)
locus
BSU29930
pI
5.80
mw
80.92 kDa
protein length
718 aa Sequence Blast
gene length
2157 bp Sequence Blast
function
starch degradation
product
pullulanase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • Gene

    Coordinates
    3,061,651 3,063,807

    The protein

    Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|52C8DE3C78B680C8883D1CD559CBC2D9ABFCC400|GlgB]
  • Structure

  • [PDB|2E8Z] (complex with alpha cyclodextrin), [PDB|2E9B] (complex with maltose)
  • Expression and Regulation

    Operons

    genes
    [gene|29A38D244A07ED0973D0846B652238524F4DBC67|ytlP]-[gene|DB1491F13F8B55A360413E815E47A2B51D24395C|ytlQ]-[gene|ED4C1EA16FF96DA20F12B972CD2458FA3B49DDA5|ytlR]-[gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    genes
    [gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]
    description
    [Pubmed|9387221]
    view in new tab

    Biological materials

    Mutant

  • BKE29930 ([gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAAGCTCTCTCCTCC, downstream forward: _UP4_TGACGAAGTTTGTGCTATAG
  • BKK29930 ([gene|7D783DD180D950A4B030BF5EA78CCE930A466A07|amyX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGAAGCTCTCTCCTCC, downstream forward: _UP4_TGACGAAGTTTGTGCTATAG
  • References

  • 16582490,9387221,19465663,24793495,31028806