SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


forespore-specific sporulation protein,similar to spore coat protein
9.07 kDa
protein length
gene length
246 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat protein/ based on similarity]
  • Gene

    2,752,802 2,753,047

    The protein

    Protein family

  • [SW|CotF family] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • BKE26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT, downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
  • BKK26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT, downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
  • References

  • 16497325