SubtiBank SubtiBank
yraG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraG

forespore-specific sporulation protein,similar to spore coat protein
locus
BSU_26950
pI
4.75
mw
9.07 kDa
protein length
gene length
246 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.2|Spore coat protein/ based on similarity]
  • Gene

    Coordinates
    2,752,802 2,753,047

    The protein

    Protein family

  • [SW|CotF family] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT, downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
  • BKK26950 ([gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26950 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGATGTAACCTCCTT, downstream forward: _UP4_AATTGAAAGGGAGGTAAGCC
  • References

  • 16497325