SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


N-acetylglucosamine-specific [SW|phosphotransferase system], EIICB of the [category|SW 1.2.2|PTS]
48.42 kDa
protein length
452 aa Sequence Blast
gene length
1359 bp Sequence Blast
N-acetylglucosamine uptake and phosphorylation
N-acetylglucosamine-specific [category|SW 1.2.2|PTS], EIICB

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.2|Phosphotransferase system] → [category|SW|Sugar specific PTS proteins]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of amino sugars]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of amino sugars]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    840,656 842,014

    Phenotypes of a mutant

  • no growth on N-acetylglucosamine [Pubmed|23667565]
  • The protein

    Protein family

  • [category|SW 1.2.2|PTS] permease, glucose family [Pubmed|10627040]
  • Paralogous protein(s)

  • [protein|4DF1740D4DFB9FD25E77C14D28AEA01707776099|GamP]
  • [SW|Domains]

  • [SW|PTS EIIB domain] type-1 (aa 375-452) (according to UniProt)
  • [SW|PTS EIIC domain] type-1 (aa 1-361) (according to UniProt)
  • Structure

  • [PDB|6BVG] (from B. cereus, the EIIC domain, corresponds to aa 3 ... 362 of NagP, 28% identity) [pubmed|29784777]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23667565], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR]: repression, [Pubmed|21602348], in [regulon|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR regulon]
  • regulation

  • induced in the presence of N-acetylglucosamine ([protein|search|NagR]) [Pubmed|21602348]
  • view in new tab

    Biological materials


  • MGNA-C339 (yflF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07700 ([gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCATCCCCCTCATAC, downstream forward: _UP4_TAAAAAAGCGGAGAGGGCAA
  • BKK07700 ([gene|7D5A8084FDDA962CCF028FC3735E68C4F2E77084|nagP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCCATCCCCCTCATAC, downstream forward: _UP4_TAAAAAAGCGGAGAGGGCAA
  • References


  • 26159076
  • Original publications

  • 10627040,18763711,10627040,6174502,23667565,21602348,23876412,30038046,29784777