SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


xanthine transport in/out via proton symport
46.08 kDa
protein length
438 aa Sequence Blast
gene length
1317 bp Sequence Blast
xanthine uptake
xanthine permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,318,127 2,319,443

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • [SW|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|PucK], [protein|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|PucJ]
  • Structure

  • [PDB|5I6C] (Aspergillus nidulans purine transporter, 27% identity) [pubmed|27088252]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098051], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, [SW|riboswitch] [Pubmed|9098051,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • induced in the absence of guanine ([SW|G-box]) [Pubmed|12787499]
  • view in new tab

    Biological materials


  • BKE22060 ([gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCGTTTTGCCGAATCCAT, downstream forward: _UP4_AAAACAGCAGTCTAACTCCG
  • BKK22060 ([gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCGTTTTGCCGAATCCAT, downstream forward: _UP4_AAAACAGCAGTCTAACTCCG
  • References

  • 12923093,11591660,9098051,11591660,18763711,27088252