SubtiBank SubtiBank
pbuX

pbuX

xanthine transport in/out via proton symport
locus
BSU_22060
pI
8.79
mw
46.08 kDa
protein length
438 aa Sequence Blast
gene length
1317 bp Sequence Blast
function
xanthine uptake
product
xanthine permease
essential
no
synonyms
ypaQ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.6|Nucleotide/ nucleoside transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,318,127 2,319,443

    The protein

    Protein family

  • [SW|xanthine/uracil permease family] (according to UniProt)
  • [SW|Nucleobase:cation symporter-2 (NCS2) (TC 2.A.40) subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|3162EF36F4441A1E4EBBFDAD19F6768D8EF21B29|PucK], [protein|53950BFDC128DE46F3F43BDB9D0FDB3D645152DF|PucJ]
  • Structure

  • [PDB|5I6C] (Aspergillus nidulans purine transporter, 27% identity) [pubmed|27088252]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]-[gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]
    description
    [Pubmed|9098051]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098051], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, [SW|riboswitch] [Pubmed|9098051,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • induced in the absence of guanine ([SW|G-box]) [Pubmed|12787499]
  • view in new tab

    Biological materials

    Mutant

  • BKE22060 ([gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCGTTTTGCCGAATCCAT, downstream forward: _UP4_AAAACAGCAGTCTAACTCCG
  • BKK22060 ([gene|7D56F85FBD3AAC66607DD7465592EEAE09D61C98|pbuX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCGTTTTGCCGAATCCAT, downstream forward: _UP4_AAAACAGCAGTCTAACTCCG
  • References

  • 12923093,11591660,9098051,11591660,18763711,27088252