SubtiBank SubtiBank
yutK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yutK

similar to Na+/nucleoside cotransporter
locus
BSU32180
pI
9.48
mw
42.12 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.6|Biosynthesis/ acquisition of nucleotides/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,307,017 3,308,231

    The protein

    Protein family

  • SLC28A transporter family (according to Swiss-Prot)
  • Structure

  • [PDB|3TIJ] (from Vibrio cholerae, 54% identity) [pubmed|22407322]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|yutK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A970 (yutK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/970 NBRP B. subtilis, Japan]
  • BKE32180 ([gene|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|yutK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATACTCGTACACCTC, downstream forward: _UP4_TAAACGATAAAAGCTCCTTG
  • BKK32180 ([gene|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|yutK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATACTCGTACACCTC, downstream forward: _UP4_TAAACGATAAAAGCTCCTTG
  • References

  • 20525796,22407322