SubtiBank SubtiBank
yutK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yutK

similar to Na+/nucleoside cotransporter
locus
BSU_32180
pI
9.48
mw
42.12 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.6|Biosynthesis/ acquisition of nucleotides/ other/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,307,017 3,308,231

    The protein

    Protein family

  • concentrative nucleoside transporter (CNT) (TC 2.A.41) family (with [protein|4F718681A7AD0C86B2551248570F493AC0B2E7E9|NupC] and [protein|C333F405F597FF260FFA0EC616B8CF6BF454815B|NupG], according to UniProt)
  • Structure

  • [PDB|3TIJ] (from Vibrio cholerae, 54% identity) [pubmed|22407322]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|yutK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A970 (yutK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/970 NBRP B. subtilis, Japan]
  • BKE32180 ([gene|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|yutK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATACTCGTACACCTC, downstream forward: _UP4_TAAACGATAAAAGCTCCTTG
  • BKK32180 ([gene|7D4CF2FF4108D3AE170C1EE3C7D494EAD46699C6|yutK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATACTCGTACACCTC, downstream forward: _UP4_TAAACGATAAAAGCTCCTTG
  • References

  • 20525796,22407322