SubtiBank SubtiBank
yhjO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhjO

similar to multidrug-efflux transporter
locus
BSU_10580
pI
9.69
mw
43.90 kDa
protein length
401 aa Sequence Blast
gene length
1206 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,132,179 1,133,384

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-B287 (yhjO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1286 NBRP B. subtilis, Japan]
  • BKE10580 ([gene|7CF92AB56695063A3061E1380929A76E675243F7|yhjO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCGCCTTTCG, downstream forward: _UP4_TAGAAAATAATTCATAATTT
  • BKK10580 ([gene|7CF92AB56695063A3061E1380929A76E675243F7|yhjO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGATCGCCGCCTTTCG, downstream forward: _UP4_TAGAAAATAATTCATAATTT