SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, similar to glucose transporter
49.03 kDa
protein length
457 aa Sequence Blast
gene length
1374 bp Sequence Blast
putative glucose transporter

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,692,533 3,693,906

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|8B0701B5694ABA8142476CB896E590FE1981D7DB|YfiG], [protein|A84AC4E40E7C722E27AE9C24ACECFEABD51B57BE|YncC], [protein|0757FAEB38AA1C599C5067794AF83A4BA5912DC9|CsbC], [protein|4A77316AA94F9C11DB70AB76711AACBD28098AA1|IolT], [protein|770D9A5BEEEABE9C3FC772E74001329206ECFAB3|AraE]
  • Structure

  • [PDB|4LDS] (from Staphylococcus epidermidis, 52% identity) [pubmed|24127585]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-A548 (ywtG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE35830 ([gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGATGACTCCCTTTC, downstream forward: _UP4_TAAAAAAGGGTGCGCGATCA
  • BKK35830 ([gene|7CE5A42042E5D52768735E795DB805530691D8A6|ywtG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGATGACTCCCTTTC, downstream forward: _UP4_TAAAAAAGGGTGCGCGATCA
  • References

  • 15805528,24127585