SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


transcriptional termination protein, involved in balanced regulation of cell motility, [category|SW 4.1.2|Biofilm formation], and [category|SW 4.2|Sporulation]
48.51 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
transcriptional termination
transcriptional termination protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Transcription elongation/ termination]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    3,803,400 3,804,683

    Phenotypes of a mutant

  • loss of motility due to poor expression of the [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon], this can be partially reversed by inactivation of [gene|920F91E748EE079FF864011D9052B073567C41E4|slrR] [pubmed|28723971]
  • no [category|SW 4.1.2|Biofilm formation], this can be suppressed by deletion of [gene|5A6FBAE6553343092862CB79E150F934978C32A9|sinR] and by switching of expression of the [gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]-[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA] antisense transcript [pubmed|28723971]
  • increased efficiency of [category|SW 4.2|Sporulation], due to enhanced [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A] phosphorylation [pubmed|28723971]
  • The protein

    Protein family

  • Rho family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|CSD domain] (aa 54-127) (according to the InterPro database)
  • Rho RNA-BD domain (aa 51-125) (according to UniProt)
  • Structure

  • [PDB|1PVO] (Rho from ''E. coli'') [Pubmed|12859904]
  • Expression and Regulation


    view in new tab

    Biological materials


  • GP2673 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::''ermC''), available in [SW|Jörg Stülke]'s lab
  • BKE37080 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACCACGCTTTT, downstream forward: _UP4_TAAATTGTATTTGCAAAAGA
  • BKK37080 ([gene|7CD46C64BE69EDADF58B634DC50C3F61BFFEC5B5|rho]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACACCACGCTTTT, downstream forward: _UP4_TAAATTGTATTTGCAAAAGA
  • References


  • 16946247,12887917,16946247,8576105,23347833,12887917,23704790,26796109,28731845,29094196
  • Original publications

  • 11566991,10027981,20075920,22383849,12859904,21040729,25112476,28723971,26857544,29931073,30845912