SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to site-2 protease
24.56 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,852,718 3,853,377

    The protein

    Protein family

  • [SW|peptidase M50B family] (according to UniProt)
  • Structure

  • [PDB|3B4R] (from Methanocaldococcus jannaschii, corresponds to aa 15 ... 166, 30% identity) [pubmed|18063795]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A518 (ywhC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37530 ([gene|7CBBC3649B7E37AC33A018C23085748AA6CA1121|ywhC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGAGATATCCCTCTTT, downstream forward: _UP4_CCGCTTTTGTAGGAGGTAGA
  • BKK37530 ([gene|7CBBC3649B7E37AC33A018C23085748AA6CA1121|ywhC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGAGATATCCCTCTTT, downstream forward: _UP4_CCGCTTTTGTAGGAGGTAGA
  • References

    Research papers

  • 18063795