SubtiBank SubtiBank
ywhC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywhC

similar to site-2 protease
locus
BSU_37530
pI
9.74
mw
24.56 kDa
protein length
219 aa Sequence Blast
gene length
660 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,852,718 3,853,377

    The protein

    Protein family

  • [SW|peptidase M50B family] (according to UniProt)
  • Structure

  • [PDB|3B4R] (from Methanocaldococcus jannaschii, corresponds to aa 15 ... 166, 30% identity) [pubmed|18063795]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7CBBC3649B7E37AC33A018C23085748AA6CA1121|ywhC]-[gene|52EB06F920EC02FD32FDE18DD4202E30D5EC8262|ywhD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A518 (ywhC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/518 NBRP B. subtilis, Japan]
  • BKE37530 ([gene|7CBBC3649B7E37AC33A018C23085748AA6CA1121|ywhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGAGATATCCCTCTTT, downstream forward: _UP4_CCGCTTTTGTAGGAGGTAGA
  • BKK37530 ([gene|7CBBC3649B7E37AC33A018C23085748AA6CA1121|ywhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTGAGATATCCCTCTTT, downstream forward: _UP4_CCGCTTTTGTAGGAGGTAGA
  • References

    Research papers

  • 18063795