SubtiBank SubtiBank
ymcB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ymcB

tRNA methylthiotransferase
locus
BSU17010
pI
6.87
mw
58.00 kDa
protein length
509 aa Sequence Blast
gene length
1530 bp Sequence Blast
function
tRNA maturation
product
tRNA methylthiotransferase
essential
no
synonyms
ymcB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,772,843 1,774,372

    The protein

    Catalyzed reaction/ biological activity

  • modifies N(6)-isopentenyladenosine (i(6)A) to 2-methylthio-N(6)-isopentenyladenosine (ms(2)i(6)A) in tRNA [Pubmed|20472640]
  • Protein family

  • MiaB subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|6ADA5AF308D96218414EA92DFF4A57BAEAD0554B|YqeV]
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|4JC0] (from Thermotoga maritima, 33% for aa 70 ... 504) [pubmed|23542644]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]-[gene|EE52DFA35B935E551871D079A9BE877DB2001A3B|ymcA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP1109 (spc), available in [SW|Jörg Stülke]'s lab
  • BKE17010 ([gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATATTTTCTCCTTT, downstream forward: _UP4_GGAGAAGCAATCGAGGTGAA
  • BKK17010 ([gene|7C9F99FF1BCDB0E1CFB0AFE959C7F16A99562E18|ymcB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17010 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATATTTTCTCCTTT, downstream forward: _UP4_GGAGAAGCAATCGAGGTGAA
  • References

  • 20472640,23542644