SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


protein serine phosphatase, septum-associated PP2C, dephosphorylation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|SpoIIAA]
91.78 kDa
protein length
827 aa Sequence Blast
gene length
2484 bp Sequence Blast
control of [protein|search|SigF ]activity, required for normal formation of the asymmetric septum
protein serine phosphatase, septum-associated PP2C

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    70,538 73,021

    Phenotypes of a mutant

  • delay of the formation of polar [protein|search|FtsZ ]rings during [SW|sporulation] [pubmed|28358838]
  • The protein

    Catalyzed reaction/ biological activity

  • dephosphorylation of [protein|3936E91C062074BFE4284B54A8CC33F35F94F5EE|SpoIIAA] (according to UniProt)
  • stabilization of [protein|search|ftsZ ]oligomers [pubmed|28358838]
  • H2O + O-phospho-L-seryl-[protein] --> L-seryl-[protein] + phosphate (according to UniProt)
  • H2O + O-phospho-L-threonyl-[protein] --> L-threonyl-[protein] + phosphate (according to UniProt)
  • Protein family

  • PP2C [SW|phosphatase]
  • [SW|Domains]

  • N-terminal trans-membrane domain [pubmed|28358838]
  • central oligomerization and FtsZ interaction domain [pubmed|28358838]
  • C-terminal PP2C phosphatase domain [pubmed|28358838]
  • [SW|PPM-type phosphatase domain] (aa 594-804) (according to UniProt)
  • [SW|Cofactors]

  • Mn 2+ [pubmed|28358838]
  • Effectors of protein activity

  • degraded by [protein|4E7B9426CED372AA8A321A147116A3A589FBF20C|FtsH], oligomerization and polar localization protect SpoIIE from degradation [Pubmed|26465112]
  • Structure

  • [PDB|5UCG] [pubmed|28527238]
  • [PDB|3T91] (phosphatase domain) [Pubmed|22115775]
  • [SW|Localization]

  • cell membrane [pubmed|28358838]
  • localizes to the polar cell division sites where it causes [protein|41872E2EF00C79918DD077F2EF78F37E24FEB110|FtsZ] to relocate from mid-cell to form polar Z-rings
  • forespore [Pubmed|26465112]
  • localizes to the cell poles (via [protein|A8C0C2B7BCA6FFFF3811402D683FB7B99F7120A4|DivIVA]) [Pubmed|26465112]
  • proper localization and stability depend on [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] [Pubmed|26929302]
  • Expression and Regulation


    (DBTBS) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1556084], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|1556084,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • view in new tab


    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • MGNA-A083 (spoIIE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00640 ([gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCATCTCCCACC, downstream forward: _UP4_TAACGCTTCCGTATAAATCA
  • BKK00640 ([gene|7C8DFE00A2B2B30CC8BEB35055D92CC2E4128F3A|spoIIE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCATCTCCCACC, downstream forward: _UP4_TAACGCTTCCGTATAAATCA
  • labs

  • [SW|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [ homepage]
  • References


  • 28500523,30855188,31350897
  • Modeling of [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF] activation

  • 24067622,22312331
  • Original Publications

  • 27415800,7570023,7570022,12180929,9077448,9364910,10323866,8622920,12007411,16824103,10476035,10747015,10322028,15978076,9495766,14744853,9642177,15866939,8846916,1556084,1948031,9573053,18077456,11846550,9150232,15205443,1556084,15687200,19578359,10049355,20817757,22115775,25101664,11846550,26465112,26929302,28358838,28527238,30092000,32630428