SubtiBank SubtiBank
ypfD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypfD

similar to ribosomal protein S1
locus
BSU_22880
pI
4.57
mw
42.24 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
jofD

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.5|Ribosomal protein/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    2,394,664 2,395,812

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bS1 family (single member, according to UniProt)
  • [SW|Domains]

  • 4 reiterated [SW|S1 domain]s (aa 16-84, aa 102-167, aa 188-256, aa 273-342) (according to UniProt)
  • Modification

  • phosphorylation on Ser-243 [Pubmed|17218307]
  • Structure

  • [PDB|5X8R] (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) [pubmed|28582576]
  • [PDB|1SRO] (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) [pubmed|9008164]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]-[gene|E91624382EC3DAABFB3123CDA818B4BEF745ACE6|fni]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|C194336ED96FA844FFE9FB43BE59ADC5D6DDB3BE|motI]-[gene|3459BA0CDAABC288ADF97B111F78C7EAC184840D|ypfB]-[gene|1ADB6E2C8DC82A242CFEFAD22443D14226F1BA60|cmk]-[gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
  • BKK22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
  • References

  • 17218307,20525796,23002217,15378759,28516784,28582576,9008164,7704259