SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to ribosomal protein S1
42.24 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Ribosomal protein/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,394,664 2,395,812

    The protein

    Protein family

  • bacterial [SW|ribosomal protein] bS1 family (single member, according to UniProt)
  • [SW|Domains]

  • 4 reiterated [SW|S1 domain]s (aa 13 ...84, aa 98 ... 167, aa 185 ... 256, aa 269 ... 342) (according to the Interpro database)
  • Modification

  • phosphorylation on Ser-243 [Pubmed|17218307]
  • Structure

  • [PDB|5X8R] (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) [pubmed|28582576]
  • [PDB|1SRO] (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) [pubmed|9008164]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation


    view in new tab

    view in new tab

    view in new tab

    view in new tab

    view in new tab

    view in new tab

    Biological materials


  • BKE22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
  • BKK22880 ([gene|7C36409F155E4C91CEE902FE6937571BD0C50128|ypfD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
  • References

  • 17218307,20525796,23002217,15378759,28516784,28582576,9008164