SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


penicillin-binding protein 5, major D-alanyl-D-alanine carboxypeptidase
48.47 kDa
protein length
443 aa Sequence Blast
gene length
1332 bp Sequence Blast
penicillin-binding protein 5, D-alanyl-D-alanine carboxypeptidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    17,534 18,865

    The protein

    Catalyzed reaction/ biological activity

  • Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala (according to UniProt)
  • Protein family

  • [SW|Peptidase S11 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|DacF]
  • Structure

  • [PDB|1XP4] (from Streptococcus pneumoniae, 37% identity) [pubmed|15596446]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • membrane associated [Pubmed|18763711]
  • during vegetative growth: septal, distinct spots at periphery [pubmed|14731276]
  • Expression and Regulation




  • the leader mRNA is processed upstream of [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • Additional information

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]∼P binds to the promoter region, but regulation has not been explored [pubmed|25666134]
  • view in new tab

    Biological materials


  • 1A742 ( ''dacA''::''cat''), [Pubmed|3087956], available at [ BGSC]
  • 1A743 ( ''dacA''::''cat''), [Pubmed|3087956], available at [ BGSC]
  • BKE00100 ([gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGTACGACCTCCGTAT, downstream forward: _UP4_TAATCAATTGAAAGAGCTCT
  • BKK00100 ([gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATCGTACGACCTCCGTAT, downstream forward: _UP4_TAATCAATTGAAAGAGCTCT
  • GFP fusion

  • 2085 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]::pSG1493 (cat Pxyl-gfpa-[gene|7C3081BC8D416127A881627EB56C0628359111CF|dacA]1-423) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • References


  • 18266855
  • Original publications

  • 9864321,18763711,14731276,10383963,23531131,23199363,26499795,15596446,29794222