SubtiBank SubtiBank
purN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purN

phosphoribosylglycinamide formyltransferase, irreversible
locus
BSU06510
pI
6.18
mw
21.63 kDa
protein length
195 aa Sequence Blast
gene length
588 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylglycinamide formyltransferase
essential
no
ec
2.1.2.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • Gene

    Coordinates
    708,010 708,597

    The protein

    Catalyzed reaction/ biological activity

  • 10-formyltetrahydrofolate + N(1)-(5-phospho-D-ribosyl)glycinamide = tetrahydrofolate + N(2)-formyl-N(1)-(5-phospho-D-ribosyl)glycinamide (according to Swiss-Prot)
  • Protein family

  • GART family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|9A399CAA672C3DF90531A7A7168916DE86EFA365|YkkE]
  • Structure

  • [PDB|3P9X] (from ''B. halodurans'', 51% identity, 70% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06510 ([gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATGCAAATACCGCAAACT, downstream forward: _UP4_TTAAATAACAGAGGTGAAAA
  • BKK06510 ([gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATGCAAATACCGCAAACT, downstream forward: _UP4_TTAAATAACAGAGGTGAAAA
  • References

  • 8121396,3036807,12923093,19574646,7638212