SubtiBank SubtiBank
ydbM [2019-05-10 15:01:31]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydbM [2019-05-10 15:01:31]

acyl-CoA dehydrogenase
locus
BSU04520
pI
5.72
mw
41.98 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
sulphur metabolism
product
acyl-CoA dehydrogenase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    505,152 506,297

    The protein

    Protein family

  • [SW|Acyl-CoA dehydrogenase family] (according to UniProt)
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • Structure

  • [PDB|3MXL] (from ''Micromonospora carbonacea var. africana'', 30% identity) [Pubmed|20866105]
  • Expression and Regulation

    Operons

    genes
    [gene|7B27ADD1CC7A9BCE0F602FA080B5FD0DB66380A0|ydbM]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • regulation

  • repressed in the presence of cysteine ([protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]) [Pubmed|16513748]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C119 (ydbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2117 NBRP B. subtilis, Japan]
  • BKE04520 ([gene|7B27ADD1CC7A9BCE0F602FA080B5FD0DB66380A0|ydbM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGGCAGCCCCCCAGTT, downstream forward: _UP4_TAAAAAAAAGAGCCTTACCG
  • BKK04520 ([gene|7B27ADD1CC7A9BCE0F602FA080B5FD0DB66380A0|ydbM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04520 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGGCAGCCCCCCAGTT, downstream forward: _UP4_TAAAAAAAAGAGCCTTACCG
  • References

  • 16513748,16513748,20866105