SubtiBank SubtiBank
mcsB [2018-05-18 15:50:54]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

mcsB [2018-05-18 15:50:54]

protein arginine kinase, tags proteins for degradation by ClpCP, adaptor protein, modulator of CtsR-dependent repression
40.97 kDa
protein length
363 aa Sequence Blast
gene length
1089 bp Sequence Blast
control of CtsR activity
protein arginine kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    102,484 → 103,575

    The protein

    Catalyzed reaction/ biological activity

  • phosphorylates and thereby targets non-functional CtsR for degradation by [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP]/[protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|20852588]
  • Protein family

  • ATP:guanido phosphotransferase family (according to Swiss-Prot)
  • Modification

  • autophosphorylation on specific arginine residues [Pubmed|20852588,21622759], dephosphorylation by [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE] [Pubmed|20852588,21622759]
  • autophosphorylation stimulates McsB activity as adaptor protein for [protein|86A2F2F65290F4471D6FD03B694821C66C180D8A|ClpC] [Pubmed|21622759]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|17434969], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8793870], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|8793870] [pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|908DB17A39D518E84977250C55825E77FA02E391|CtsR]: repression, [pubmed|9987115,11179229,16163393,17380125], in [regulon|908DB17A39D518E84977250C55825E77FA02E391|CtsR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30962353], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • expressed during germination and spore outgrowth [Pubmed|24244006]
  • induction during diamide stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30962353]
  • view in new tab

    Biological materials


  • MGNA-B930 (yacI::erm), available at the [ NBRP B. subtilis, Japan]
  • ''mcsB::aphA3'' availbale from the Gerth lab
  • mcsBC167S::spec available from the Gerth lab
  • GP1457 (''mcsB''::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BP69 (spc), available in [SW|Fabian Commichau]'s lab
  • BKE00850 (Δ[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC
  • BKK00850 (Δ[gene|7B1B664A1AE1F641E8E7D9E2894D5C8FFFA92948|mcsB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC
  • Expression vector

  • for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab
  • expression of native ''mcsB'' in ''B. subtilis'': pBP186 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab
  • Antibody

  • available in Gerth lab
  • Labs working on this gene/protein

  • [SW|Ulf Gerth], Greifswald, Germany
  • [SW|Fabian Commichau] Göttingen, Germany
  • References


  • 23375660,19609260,28748186
  • Original Publications

  • 17380125,16163393,19498169,11179229,9987115,8793870,16497325,19226326,9987115,11544224,20852588,21622759,22517742,24825175,24263382,25610436,26458230,27749819