SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter] for guanosine (membrane protein)
33.58 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
uptake of guanosine
[SW|ABC transporter] for guanosine

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,243,657 3,244,616

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21926227], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455,21699902,21926227], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12618455,21699902,21926227]
  • view in new tab

    Biological materials


  • MGNA-A636 (yufQ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE31570 ([gene|7A80910F4E62BA15DE93FFC70E1908FB5CB9542D|nupQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATAAAATCTGCACAATGT, downstream forward: _UP4_TAAACATTCTCCCCTGGGAA
  • BKK31570 ([gene|7A80910F4E62BA15DE93FFC70E1908FB5CB9542D|nupQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGATAAAATCTGCACAATGT, downstream forward: _UP4_TAAACATTCTCCCCTGGGAA
  • References

  • 10092453,21926227,12618455