SubtiBank SubtiBank
yfkT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfkT

general stress protein, part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|YfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|YfkT] germinant receptor of unknown specificity
locus
BSU07760
pI
9.77
mw
40.20 kDa
protein length
358 aa Sequence Blast
gene length
1077 bp Sequence Blast
function
germination
product
part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|YfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|YfkT] germinant receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    846,182 847,258

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[gene|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[gene|AA76BEF6A4CECB5D3910918E8D91D8B919EDEA7E|yfkS]-[gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C343 (yfkT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2341 NBRP B. subtilis, Japan]
  • BKE07760 ([gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCACATCCTTTCTG, downstream forward: _UP4_TTGTTCGGCGCAAAAGCAAA
  • BKK07760 ([gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCACATCCTTTCTG, downstream forward: _UP4_TTGTTCGGCGCAAAAGCAAA
  • References

  • 15805528,15699190,22383849,10762253,27766092