SubtiBank SubtiBank
yfkT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfkT

general stress protein, part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|YfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|YfkT] germinant receptor of unknown specificity
locus
BSU_07760
pI
9.77
mw
40.20 kDa
protein length
358 aa Sequence Blast
gene length
1077 bp Sequence Blast
function
germination
product
part of the [protein|7CE0CAF27B1C0F507E783B8B80622270B00634FD|YfkQ]-[protein|B7EEC1910715507596734540D24B3C93B4B7065F|YfkR]-[protein|7A62875A659B9F0967C392F38895D9E15A29D559|YfkT] germinant receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    846,182 847,258

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • [SW|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7CE0CAF27B1C0F507E783B8B80622270B00634FD|yfkQ]-[gene|B7EEC1910715507596734540D24B3C93B4B7065F|yfkR]-[gene|AA76BEF6A4CECB5D3910918E8D91D8B919EDEA7E|yfkS]-[gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C343 (yfkT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2341 NBRP B. subtilis, Japan]
  • BKE07760 ([gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCACATCCTTTCTG, downstream forward: _UP4_TTGTTCGGCGCAAAAGCAAA
  • BKK07760 ([gene|7A62875A659B9F0967C392F38895D9E15A29D559|yfkT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGCACATCCTTTCTG, downstream forward: _UP4_TTGTTCGGCGCAAAAGCAAA
  • References

  • 15805528,15699190,22383849,10762253,27766092