SubtiBank SubtiBank
ohrR [2019-03-11 12:22:26]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ohrR [2019-03-11 12:22:26]

transcription repressor of the ohrA gene
locus
BSU13150
pI
6.36
mw
16.86 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
regulation of ohrA expression in response to organic peroxides
product
transcription repressor (MarR family)
essential
no
synonyms
ykmA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,381,434 1,381,877

    The protein

    Protein family

  • [SW|MarR family]
  • Modification

  • senses organic peroxides and NaOCl, released from DNA upon oxidation of an active site cysteine
  • S-bacillithiolated by NaOCl and CHP stress on Cys-15, this results in release from the'' [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]'' promoter [Pubmed|21749987]
  • Structure

  • [PDB|1Z91] (reduced form), [PDB|1Z9C] (complex with ''[gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]'' promoter)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7A3A8AF7728474204396BB7A548F747D28E6FAC7|ohrR]
    description
    [Pubmed|9696771]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A750 (ykmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/750 NBRP B. subtilis, Japan]
  • BKE13150 ([gene|7A3A8AF7728474204396BB7A548F747D28E6FAC7|ohrR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCACCAACTCTT, downstream forward: _UP4_TGAGGATGCCTTGTACAGGC
  • BKK13150 ([gene|7A3A8AF7728474204396BB7A548F747D28E6FAC7|ohrR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCACCAACTCTT, downstream forward: _UP4_TGAGGATGCCTTGTACAGGC
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
  • References

    Reviews

  • 22797754,20626317,19575568,20094649,25852656
  • Original Publications

  • 21749987,16209951,18487332,17660290,17502599,12486061,11418552,18586944,11983871,18363800,19129220,9696771,21749987,22797754,24313874