SubtiBank SubtiBank
ohrR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ohrR

transcription repressor of the [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA] gene
locus
BSU_13150
pI
6.36
mw
16.86 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
regulation of [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA] expression in response to organic peroxides
product
transcription repressor ([SW|MarR family])
essential
no
synonyms
ykmA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,381,434 1,381,877

    The protein

    Protein family

  • [SW|MarR family]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 11-141) (according to UniProt)
  • Modification

  • senses organic peroxides and NaOCl, released from DNA upon oxidation of an active site cysteine
  • S-bacillithiolated by NaOCl and CHP stress on Cys-15, this results in release from the'' [gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]'' promoter [Pubmed|21749987]
  • Structure

  • [PDB|1Z91] (reduced form), [PDB|1Z9C] (complex with ''[gene|869E46AECF6249610F8541E403D834284B62171D|ohrA]'' promoter)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|7A3A8AF7728474204396BB7A548F747D28E6FAC7|ohrR]
    description
    [Pubmed|9696771]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • GP3172 [gene|7A3A8AF7728474204396BB7A548F747D28E6FAC7|ohrR]::kan trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-A750 (ykmA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/750 NBRP B. subtilis, Japan]
  • BKE13150 ([gene|7A3A8AF7728474204396BB7A548F747D28E6FAC7|ohrR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCACCAACTCTT, downstream forward: _UP4_TGAGGATGCCTTGTACAGGC
  • BKK13150 ([gene|7A3A8AF7728474204396BB7A548F747D28E6FAC7|ohrR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCACCAACTCTT, downstream forward: _UP4_TGAGGATGCCTTGTACAGGC
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • [SW|Richard Brennan], Houston, Texas, USA [http://www.mdanderson.org/departments/biochem/display.cfm?id=556ef368-6c81-4043-b74f350d41dd06cb&method=displayfull&pn=a8427ebd-d0ff-11d4-80fd00508b603a14 Homepage]
  • References

    Reviews

  • 22797754,20626317,19575568,20094649,25852656
  • Original Publications

  • 21749987,16209951,18487332,17660290,17502599,12486061,11418552,18586944,11983871,18363800,19129220,9696771,21749987,22797754,24313874