SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


branched-chain amino acid transporter
11.83 kDa
protein length
110 aa Sequence Blast
gene length
333 bp Sequence Blast
export of branched-chain amino acids
component of branched-chain amino acid transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,728,647 2,728,979

    The protein

    Protein family

  • AzlD/HI_1737/HP1330 family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB]: repression, [Pubmed|9287000], in [regulon|D7397591C2157EBB1951ED3DC1E315F9AE7A4BB3|AzlB regulon]
  • regulation

  • repressed by [protein|search|AzlB] [Pubmed|9287000]
  • view in new tab

    Biological materials


  • BKE26700 ([gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTGCGTCATAGTCA, downstream forward: _UP4_TAACCGATATCGGAAACGAT
  • BKK26700 ([gene|7A1445B7AFD9C3AA45EF67E51F5D233FCC5F8884|azlD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCTGCGTCATAGTCA, downstream forward: _UP4_TAACCGATATCGGAAACGAT
  • References

  • 9287000,12081967