SubtiBank SubtiBank
fbp
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

fbp

fructose-1,6-bisphosphatase, involved in gluconeogenesis
locus
BSU_40190
pI
5.60
mw
77.80 kDa
protein length
671 aa Sequence Blast
gene length
2016 bp Sequence Blast
function
gluconeogenesis
product
fructose-1,6-bisphosphatase
essential
no
ec
3.1.3.11
synonyms
fdp,yydE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • Gene

    Coordinates
    4,128,029 4,130,044

    The protein

    Catalyzed reaction/ biological activity

  • β-D-fructose 1,6-bisphosphate + H2O --> β-D-fructose 6-phosphate + phosphate (according to UniProt)
  • Protein family

  • FBPase class 3 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|79DD9B2E2EBB4646327AFC2148CE040823DE89D3|fbp]
    description
    [pubmed|22383849,9696785]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|9696785], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B811 (yydE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1810 NBRP B. subtilis, Japan]
  • BKE40190 ([gene|79DD9B2E2EBB4646327AFC2148CE040823DE89D3|fbp]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACCGTCCATCCCCTTT, downstream forward: _UP4_TGAGGGGTGTGGGGTTCAGG
  • BKK40190 ([gene|79DD9B2E2EBB4646327AFC2148CE040823DE89D3|fbp]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40190 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACCGTCCATCCCCTTT, downstream forward: _UP4_TGAGGGGTGTGGGGTTCAGG
  • References

  • 6257649,221467,9696785,24571712