SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ammonium transporter, required at low ammonium concentration
42.57 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
ammonium uptake
ammonium transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,756,790 3,758,004

    The protein

    Protein family

  • ammonia transporter channel (TC 1.A.11.2) family (single member, according to UniProt)
  • Structure

  • [PDB|4NH2] (from ''E. coli'') [Pubmed|17220269]
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8282685], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced by ammonium limitation
  • view in new tab

    Biological materials


  • GP739 (cat), GP255 (''[gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]-[gene|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|nrgB]'', cat), both available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • 1A920 ( ''nrgA''::''erm''), [Pubmed|8282685], available at [ BGSC]
  • BKE36510 ([gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCATTCCTCCGTAT, downstream forward: _UP4_GATTCTATGTGAGGAGTGAC
  • BKK36510 ([gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCATTCCTCCGTAT, downstream forward: _UP4_GATTCTATGTGAGGAGTGAC
  • lacZ fusion

  • pGP168 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • labs

  • [SW|Susan Fisher], Boston, USA [ homepage]
  • References


  • 10637624,17368911
  • Original Publications

  • 12823818,17001076,8799114,14600241,8282685,1670935,17220269,25229891,25755103