SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


ammonium transporter, required at low ammonium concentration
42.57 kDa
protein length
404 aa Sequence Blast
gene length
1215 bp Sequence Blast
ammonium uptake
ammonium transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Uptake of other small ions]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of glutamate/ glutamine/ ammonium assimilation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,756,790 3,758,004

    The protein


  • [PDB|4NH2] (from ''E. coli'') [Pubmed|17220269]
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8282685], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|8799114], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • induced by ammonium limitation
  • view in new tab

    Biological materials


  • GP739 (cat), GP255 (''[gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]-[gene|EC7C2A0B5A9A30B2FAA0CF9EEB9830CE0E6F2219|nrgB]'', cat), both available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • 1A920 ( ''nrgA''::''erm''), [Pubmed|8282685], available at [ BGSC]
  • BKE36510 ([gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCATTCCTCCGTAT, downstream forward: _UP4_GATTCTATGTGAGGAGTGAC
  • BKK36510 ([gene|796BD46066B1E6147048664FA78679B42FA9D628|nrgA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTCATTCCTCCGTAT, downstream forward: _UP4_GATTCTATGTGAGGAGTGAC
  • lacZ fusion

  • pGP168 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab [Pubmed|14600241]
  • labs

  • [SW|Susan Fisher], Boston, USA [ homepage]
  • References


  • 10637624,17368911
  • Original Publications

  • 12823818,17001076,8799114,14600241,8282685,1670935,17220269,25229891,25755103