SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


membrane-anchored protein quality control protease, serine protease, response to secretion and heat stresses
48.55 kDa
protein length
458 aa Sequence Blast
gene length
1377 bp Sequence Blast
protein quality control
serine protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Protein quality control]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,384,070 3,385,446

    The protein

    Protein family

  • Peptidase S1C family (with [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA] and [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|HtrC], according to UniProt)
  • [SW|Domains]

  • cytoplasmic domain (aa 1 - 71) (according to UniProt)
  • transmembrane helix (aa 72 - 92) (according to UniProt)
  • extracellular domain (aa 93 - 458) (according to UniProt)
  • [SW|PDZ domain] (aa 350- 449) (according to UniProt)
  • Structure

  • [PDB|3QO6] (from ''Arabidopsis thaliana'', 38% identity) [Pubmed|21532594]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • randomly distributed in foci throughout the cell surface [Pubmed|22307758]
  • Expression and Regulation



    regulatory mechanism

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, [Pubmed|12270824], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • expressed under conditions of secretion stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]) [Pubmed|12270824]
  • additional information

  • [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|HtrB] is subject to degradation by [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] and other extracellular proteases [PubMed|24362423]
  • view in new tab

    Biological materials


  • MGNA-B207 (yvtA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33000 ([gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA, downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG
  • BKK33000 ([gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA, downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG
  • References


  • 22688815,21326199,25212246,31001739
  • Original publications

  • 17600057,22307758,12270824,22092710,24362423,24115457,11133960,21532594