SubtiBank SubtiBank
htrB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

htrB

membrane-anchored protein quality control protease, serine protease, response to secretion and heat stresses
locus
BSU_33000
pI
4.63
mw
48.55 kDa
protein length
458 aa Sequence Blast
gene length
1377 bp Sequence Blast
function
protein quality control
product
serine protease
essential
no
ec
3.4.21.107
synonyms
yvtA,yvtB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.1|Protein quality control]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,384,070 3,385,446

    The protein

    Catalyzed reaction/ biological activity

  • Acts on substrates that are at least partially unfolded. The cleavage site P1 residue is normally between a pair of hydrophobic residues, such as Val-|-Val (according to UniProt)
  • Protein family

  • Peptidase S1C family (with [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA] and [protein|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|HtrC], according to UniProt)
  • [SW|Domains]

  • cytoplasmic domain (aa 1 - 71) (according to UniProt)
  • transmembrane helix (aa 72 - 92) (according to UniProt)
  • extracellular domain (aa 93 - 458) (according to UniProt)
  • [SW|PDZ domain] (aa 350- 449) (according to UniProt)
  • Structure

  • [PDB|3QO6] (from ''Arabidopsis thaliana'', 38% identity) [Pubmed|21532594]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • randomly distributed in foci throughout the cell surface [Pubmed|22307758]
  • Expression and Regulation

    Operons

    genes
    [gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]: activation, [Pubmed|12270824], in [regulon|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR regulon]
  • regulation

  • expressed under conditions of secretion stress ([protein|A40CD2C23A19860342F440284302EFFDAC09E88A|CssR]) [Pubmed|12270824]
  • additional information

  • [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|HtrB] is subject to degradation by [protein|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|WprA] and other extracellular proteases [PubMed|24362423]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B207 (yvtA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1206 NBRP B. subtilis, Japan]
  • BKE33000 ([gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA, downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG
  • BKK33000 ([gene|796216BE9CD6DADFEADC29497253C81BF496A2ED|htrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCTTACACTCCTTTA, downstream forward: _UP4_TAAGAAAAAACAAAAAGCTG
  • References

    Reviews

  • 22688815,21326199,25212246,31001739
  • Original publications

  • 17600057,22307758,12270824,22092710,24362423,24115457,11133960,21532594